Rigor Reviewed

Rigor-Reviewed Manuscript

Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.

Name: Adcurare Rigor Record — Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.
Item: Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.
Rating: 39
Author: Adcurare

Kapulu MC, Orenge F, Kimani D, Kibwana E, Kibet H, Mutahi M, Datoo MS, Bellamy D, Musembi J, Ngoto O, Rashid H, Akinyi S, Mwatasa MH, Nyamako L, Keter K, Gatheru R, Mutiso A, Musyoki J, Mwacharo J, Abebe Y, James ER, Billingsley PF, Ngetsa C, Mosobo M, Makale J, Tawa B, Wamae K, Ochola-Oyier LI, Lawrie A, Ramos-Lopez F, Roberts R, Richie TL, Sim BKL, Hoffman SL, Ewer KJ, Hill AVS, Hamaluba M, Bejon P

Paper source

Read full text (PMC)Journal

Embed this Rigor badge

Adcurare Rigor Review — 1★ (Critical), 2 critical, 5 high issues for “Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.”

Links back to this Rigor Record.

Adcurare Editorial

This rigor review was examined and confirmed by Adcurare Editorial · July 7, 2026

Adcurare Rigor Review

Rigor Reviewed

1 / 5

Critical — a demonstrable failure

Interventional Study

Critical

High-priority

How this rating was calculated▸

Started at 5★ — deductions

StatisticsStatistic did not reproduce ×3−1.5★
ClaimsOverstated claim ×2−1★
CitationsUnresolved reference ×3−0.75★
ReportingStudy design partially met−0.25★
ReportingStatistical analysis partially met−0.25★
ReportingData & code availability partially met−0.25★

A demonstrable critical failure caps the rating at the minimum, regardless of the deductions above.

Model-reported confidence: moderateReviewer agreement: moderateEngine: 7.6.0Source: full text

Problems surfaced6 types

Summary statistic impossible for the stated N (GRIM/GRIMMER)
Statistical reporting gaps (tests, assumptions, effect sizes)
Conclusions overstated beyond the evidence
Data/code availability incomplete
Study-design details incomplete (controls, blinding, power)
References not resolvable to a published paper

This Adcurare Rigor Review uses AI Rigor Reviewers trained on a curated corpus of high-fidelity and retracted papers, with expert supervision and curation. It can still make mistakes; verify each finding against the source before relying on it.

Critical findings

• PERCENT: 96.1% does not match the reported count 75/78
• PERCENT: 12% does not match the reported count 3/24
• PERCENT: 32% does not match the reported count 12/37

The paper reports a well-designed but open-label human challenge trial with strong scientific premise and ethical governance, but several reporting gaps weaken its overall rigor: no power analysis for the primary comparison, no effect sizes/confidence intervals for the key result, missing code sharing, limited health-status baseline data, and incomplete versioning of resources.

All 8 dimensions were applicable and scored. The three independent reviewers largely converged; the synthesis downgraded biological variables to warn based on Reviewer 3's specific evidence about missing health-status detail. Citation checks flagged 3 references as not found in registry; no retractions. Statistics verification checked 5 reported values (3 inconsistent, but none flagged as decision errors — see coverage note).

12 major claims checked against the paper's own evidence: 2 not fully backed by the presented evidence (unsupported or overstated).

Recomputed 2 tests: 2 consistent, 0 inconsistent, 2 via agent-written checks. 3 reported summary statistics mathematically impossible for the stated N (GRIM/GRIMMER).

Reporting

Eight Dimensions5 pass · 3 warn

The paper clearly establishes the biological rationale: anti-CSP antibodies block sporozoites, animal models suggest dermal sporozoites are more readily blocked than intravenous ones, and human CHMI studies have not separately tested ID vs DVI routes. Prior work on R21/Matrix-M and RTS,S is cited, and the limitations of mixed-route mosquito bite CHMI are acknowledged. The hypothesis that vaccine efficacy varies by inoculation route follows logically from the cited evidence.

Sub-criteria

prior work citedADEQUATE

premise rationaleADEQUATE

limitations addressedADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 95% conf

The scientific premise is well-grounded, citing prior research on anti-CSP antibody protection, animal models showing route-dependent efficacy, and the gap in human CHMI studies comparing ID vs DVI challenge.

Evidence

paraphrase[Introduction, paragraphs 1-5]

“The Introduction cites RTS,S and R21 efficacy data, animal studies showing ID sporozoites are more readily blocked than IV, and states 'there are no CHMI studies that compare anti-CSP antibodies against different routes of inoculation of sporozoites in human volunteers.'”

direct quote[Introduction, paragraph 5]

“We therefore hypothesized that vaccine protection might vary according the route of inoculation (that is, ID versus DVI).”

direct quote[Introduction, paragraph 7]

“However, where sensitivity to the anti-CSP antibodies induced by vaccination may vary for ID and for intravenous sporozoites, then the mixture of inoculation routes in infectious mosquito bites introduces noise and precludes a definitive measurement of correlates of efficacy.”

PASSReviewer 2· 95% conf

The paper clearly establishes the scientific premise by citing prior research on anti-CSP antibodies, previous CHMI studies, and the animal model observation that dermal sporozoites are more readily blocked by antibodies than venous ones.

Evidence

direct quote[Introduction, paragraphs 1-3]

“It is unclear why antibody-based protection remains partial despite high levels of anti-CSP antibodies induced by vaccines or high concentrations of circulating monoclonal antibodies.”

direct quote[Introduction, paragraph 4]

“We therefore hypothesized that vaccine protection might vary according the route of inoculation (that is, ID versus DVI).”

direct quote[Introduction, paragraph 5]

PASSReviewer 3· 95% conf

The premise is clearly established with citations to prior work on anti-CSP antibodies, animal model data on route-dependent protection, and the gap in human CHMI studies comparing routes.

Evidence

direct quote[Introduction, paragraphs 1-3, 5]

“Furthermore, in animal models, dermal sporozoites are more readily blocked by anti-CSP antibodies compared to intravenous sporozoites.”

direct quote[Introduction, paragraph 5]

“We therefore hypothesized that vaccine protection might vary according the route of inoculation (that is, ID versus DVI).”

direct quote[Introduction, paragraph 6]

For a human RCT, the checklist items randomization_method, randomization_unit, inclusion_exclusion, and controls (comparator arms) are adequate. The power_analysis is reported_but_inadequate: it mentions 90% power to detect 40% efficacy with n=20, but the actual DVI group had n=5, far below that. The study is open-label; blinding_levels is 'reported_but_inadequate' because the rationale given (impractical placebo + objective PCR outcome and blind lab) is reasonable but the lack of participant and investigator blinding is a potential source of bias for subjective safety outcomes. independent_replication is not_applicable (single pivotal challenge trial). Outlier handling is not reported (none pre-specified). Replicate_distinction is not_applicable (human trial).

Sub-criteria

controlsADEQUATE

power analysisINADEQUATE

blinding levelsINADEQUATE

outlier handlingNOT REPORTED

randomization unitADEQUATE

inclusion exclusionADEQUATE

randomization methodADEQUATE

replicate distinctionN/A

independent replicationN/A

Per reviewer (3) — the votes behind the verdict

WARNReviewer 1· 85% conf

The study design is a randomized, open-label controlled trial with some strengths (randomization method described, inclusion/exclusion criteria listed) but has key weaknesses: no blinding, use of historical controls, no power analysis specific to the primary comparison, and no independent replication.

Evidence

direct quote[Methods, 'Enrollment and randomization']

“The volunteers were randomly assigned with randomization via a computer-generated sequence by an independent statistician. A randomization list in the form of password protected spreadsheet was generated using STATA and the data manager setup randomization in REDCap. Study clinicians only clicked to randomize after confirmation of eligibility criteria and immediately before vaccination for each volunteer, after which REDCap would reveal the volunteers' randomization arm that could not be edited.”

direct quote[Methods, paragraph 1]

“The study was open label as (1) placebo for the different doses and routes would have been impractical and (2) outcomes were based on objective PCR data and the laboratory team were blind to allocations.”

direct quote[Results, 'Primary outcomes']

“Historically unvaccinated control volunteers who had previously undergone CHMI with PfSPZ challenge by DVI showed similar growth rates to PfSPZ challenge ID volunteers...”

absence[Methods, 'Statistical analysis']

No power analysis reported for the primary comparison of ID vs DVI in R21 vaccinees.

WARNReviewer 2· 85% conf

While randomization and inclusion/exclusion criteria are well reported, the study lacks blinding (stated open-label), has no a priori power analysis linked to the primary comparison of interest, and relies on historical controls for the DVI group.

Evidence

direct quote[Methods, paragraph 1]

direct quote[Methods, Statistical analysis]

“Using a comparison of proportions and assuming P = 0.05 and 100% infection rates in the control group, we predicted 90% power to detect 40% efficacy with n = 20 groups and 80% power to detect 60% efficacy with n = 10.”

direct quote[Results, Primary outcomes, paragraph 2 and Discussion, paragraph 4]

“Historically unvaccinated control volunteers who had previously undergone CHMI with PfSPZ challenge by DVI showed similar growth rates to PfSPZ challenge ID volunteers”

WARNReviewer 3· 90% conf

The study design is generally appropriate for a human challenge trial, but several key elements are missing or inadequately reported: no sample-size justification linked to the primary comparison, the historical control for the DVI arm is not a concurrent control, and blinding is absent with only a partial rationale.

Evidence

direct quote[Methods, paragraph 2]

“The volunteers were randomly assigned with randomization via a computer-generated sequence by an independent statistician.”

direct quote[Methods, 'Statistical analysis']

direct quote[Methods, paragraph 1]

The paper reports sex, age, and BMI in Table 1. The predominance of male volunteers is noted and linked to established gender roles in the study area. Health status is documented through inclusion/exclusion criteria and baseline laboratory assessments. Species and strain are not applicable as this is a human trial. Housing conditions are not applicable.

Sub-criteria

demographicsADEQUATE

sex reportedADEQUATE

sex justifiedN/A

age weight healthADEQUATE

housing conditionsN/A

species strain sourceN/A

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

Biological variables are adequately reported: sex, age, and baseline health status are given for the study population. Demographics are provided for this human trial.

Evidence

paraphrase[Table 1]

“Table 1 reports mean age, sex distribution (percentage male/female), and mean BMI for each vaccination and challenge group.”

direct quote[Results, 'Participant demographics']

“There was a predominance of young male volunteers (28/40, 70%) with a mean age of 28.3 years (Table ). The male predominance among volunteers appears to relate to established gender roles .”

paraphrase[Results, 'Participant demographics']

“Exclusion criteria included clinically significant lab abnormalities, abnormal blood tests were documented for those excluded, and volunteers were qPCR negative for malaria before CHMI.”

PASSReviewer 2· 90% conf

Sex, age, BMI, and health status are reported for all participants. Demographics including ethnicity (Mijikenda) and location are provided. Species and strain of the challenge parasite are identified (P. falciparum NF54, Sanaria PfSPZ Challenge).

Evidence

direct quote[Table 1]

“Male, % (n/N) | 83.3% (10/12) | 71.4% (5/7) | 66.7% (8/12) | 55.6% (5/9)”

direct quote[Methods, CHMI]

“We used P. falciparum NF54 sporozoites (Sanaria PfSPZ challenge (NF54)) using two alternative inoculation routes”

direct quote[Results, Participant demographics]

“Volunteers were from the Mijikenda ethnic group.”

WARNReviewer 3· 85% conf

Sex, age, and some demographics are reported, but health status details are limited to broad eligibility criteria, and there is no reporting of comorbidities or prior malaria history that might affect immune responses.

Evidence

direct quote[Table 1]

“Age in years, mean (s.d.) | 28.2 (6.1) ... Male, % (n/N) | 83.3% (10/12) ... BMI, kg m−2, mean (s.d.) | 21.69 (1.7)”

paraphrase[Results, 'Participant demographics']

“Paraphrase: The paper lists exclusion criteria but does not report the baseline health status or comorbidity profile of enrolled participants.”

The paper reports approvals from a National IRB in Kenya (KEMRI/SERU/CGMR-C/158/3844) and the relevant Oxford IRB (OxTREC 32-19). Informed consent was obtained (written informed consent mentioned). The study is registered with ClinicalTrials.gov and PACTR. Compliance with regulatory requirements is stated, including the use of Sanaria PfSPZ under an FDA IND.

Sub-criteria

iacuc statementN/A

informed consentADEQUATE

irb ethics statementADEQUATE

regulatory complianceADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 95% conf

Ethical approvals are adequately documented: named IRBs (KEMRI and Oxford) with protocol numbers, informed consent described, and regulatory compliance stated.

Evidence

direct quote[Methods, 'Ethics']

“Before commencing activity, approvals were obtained from a National IRB in Kenya and the relevant Oxford IRB (ERU (KEMRI/SERU/CGMR-C/158/3844) and OxTREC (OxTREC 32-19)) and from the medicines regulatory authority in Kenya (Pharmacy and Poisons Board (ECCT/19/11/01)).”

direct quote[Methods, 'Study volunteers and eligibility']

“Following written informed consent, we recruited healthy adult men and women...”

direct quote[Methods, 'Ethics']

“The use of Sanaria PfSPZ challenge (NF54) was done in accordance with an investigational new drugs application with the US Food and Drug Administration.”

PASSReviewer 2· 95% conf

Ethical approvals from named Kenyan and UK IRBs with protocol numbers are reported, informed consent is described, and regulatory compliance with the US FDA is stated.

Evidence

direct quote[Methods, Ethics]

“approvals were obtained from a National IRB in Kenya and the relevant Oxford IRB (ERU (KEMRI/SERU/CGMR-C/158/3844) and OxTREC (OxTREC 32-19))”

direct quote[Methods, Study volunteers and eligibility]

“Following written informed consent, we recruited healthy adult men and women”

direct quote[Methods, Ethics]

“The use of Sanaria PfSPZ challenge (NF54) was done in accordance with an investigational new drugs application with the US Food and Drug Administration.”

PASSReviewer 3· 95% conf

Ethical approvals from named IRBs in Kenya and Oxford are stated with protocol numbers, informed consent is described, and regulatory compliance with investigational new drug applications is noted.

Evidence

direct quote[Methods, 'Ethics']

“approvals were obtained from a National IRB in Kenya and the relevant Oxford IRB (ERU (KEMRI/SERU/CGMR-C/158/3844) and OxTREC (OxTREC 32-19))”

direct quote[Methods, 'Study volunteers and eligibility']

“Following written informed consent”

direct quote[Methods, 'Ethics']

“The use of Sanaria PfSPZ challenge (NF54) was done in accordance with an investigational new drugs application with the US Food and Drug Administration.”

R21/Matrix-M is identified with its adjuvant (Novavax Matrix-M) and dose (10 μg + 50 μg). ChAd63/MVA ME-TRAP is identified. Sanaria PfSPZ Challenge is identified with the specific dose (3,200 DVI, 22,500 ID). The qPCR primers are given verbatim. Software tools identified include SeekDeep version 3.0.110, STATA, REDCap, and AID automated ELISPOT counter. No antibody catalog numbers are reported (ELISA used, but detection antibodies not specified), but this is a clinical trial and the relevant resource is the investigational product, which is adequately identified.

Sub-criteria

mycoplasma testingN/A

reagents identifiedADEQUATE

organisms identifiedADEQUATE

antibodies identifiedN/A

cell line authenticationN/A

software tools identifiedADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 85% conf

Key resources are adequately identified: vaccines (R21/Matrix-M, ChAd63/MVA ME-TRAP) are described with manufacturer/source, and software tools are named with versions. The human challenge agent (Sanaria PfSPZ) is identified.

Evidence

paraphrase[Methods, 'Vaccines and vaccination' and 'CHMI']

“R21/Matrix-M is described as a protein-in-adjuvant vaccine with Matrix-M, and the viral vectors ChAd63 and MVA ME-TRAP are named. The challenge agent is Sanaria PfSPZ Challenge (NF54).”

paraphrase[Methods, 'Statistical analysis' and 'Parasite genotyping']

“STATA is mentioned for generating the randomization list, and SeekDeep version 3.0.110 is named for sequence analysis. However, versions for other software (e.g., qPCR analysis software) are not reported.”

direct quote[Methods, 'qPCR for parasite detection']

“18S Pf forward-5′GTAATTGGAATGATAGGAATTTACAAGGT 3′; 18S Pf Reverse-5' TCAACTACGAACGTTTTAACTGCAAC 3′; 18S Pf MGB -5′ FAM- AACAATTGGAGGGCAAG-NFQ-MGB 3′”

PASSReviewer 2· 90% conf

The investigational vaccines and challenge agent are well identified with manufacturer and dose information. Software tools are named with versions. PCR primers and ELISpot peptides are specified.

Evidence

direct quote[Methods, Vaccines and vaccination]

“R21 was thawed to room temperature then mixed with Matrix-M before administration (10 μg mixed with Matrix-M 50 μg) and administered intramuscularly.”

direct quote[Methods, CHMI]

“Challenge was administered in a volume of 0.5 ml using a needle and syringe by DVI at the standard dose of 3,200 PfSPZ challenge.”

direct quote[Methods, qPCR for parasite detection]

“18S Pf forward-5′GTAATTGGAATGATAGGAATTTACAAGGT 3′; 18S Pf Reverse-5’ TCAACTACGAACGTTTTAACTGCAAC 3′”

WARNReviewer 3· 90% conf

The investigational product (R21/Matrix-M) is identified, but details on formulation and lot numbers are missing; the viral vector vaccines are named, and software (STATA, REDCap) is identified with partial versioning. Antibodies, cell lines, and mycoplasma testing are not applicable.

Evidence

direct quote[Methods, 'Vaccines and vaccination']

“R21 was thawed to room temperature then mixed with Matrix-M before administration (10 μg mixed with Matrix-M 50 μg) and administered intramuscularly.”

direct quote[Methods, 'Enrollment and randomization']

“A randomization list in the form of password protected spreadsheet was generated using STATA and the data manager setup randomization in REDCap.”

The primary analysis uses log-rank testing across survival curves; exact p-values are provided (P < 0.0005, P = 0.0001, etc.). Fisher's exact test for the sensitivity analysis is reported with P = 0.009. Anti-NANP antibody comparisons use Kruskal-Wallis with P = 0.14. Effect sizes with 95% CIs are reported for the immunogenicity data (e.g., geometric mean 735 s.f.u., 95% CI 364–1,485). However, for the critical primary outcome of R21 ID vs DVI, no effect size or confidence interval is reported — only the log-rank p-value and the proportion comparison. Assumptions for the statistical tests (proportional hazards for log-rank) are not explicitly verified. A post-hoc sensitivity analysis is reported.

Sub-criteria

tests namedADEQUATE

exact p valuesADEQUATE

effect sizes ciINADEQUATE

data presentationADEQUATE

software identifiedADEQUATE

assumptions verifiedNOT REPORTED

mathematical plausibilityN/A

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 85% conf

Statistical methods are appropriate and adequately reported: tests are named, exact p-values are provided, and data presentation includes individual points. A minor limitation is the lack of explicit verification of test assumptions, but this is acceptable for a trial using log-rank tests and Fisher's exact test.

Evidence

direct quote[Results, 'Primary outcomes' and 'Sensitivity analysis']

“P < 0.0005 by log-rank survival across all groups; P = 0.009 by Fisher’s two-sided test.”

direct quote[Results, 'Primary outcomes' and 'Secondary outcomes']

“P = 0.14; P = 0.01; P = 0.064; P = 0.001; P = 0.084; P = 0.0009; P = 0.4”

paraphrase[Figures 2 and 3]

“Figure 2 shows individual qPCR parasite growth curves per subject, and Figure 3 shows Kaplan-Meier survival curves for the primary endpoint.”

absence[Methods, 'Statistical analysis']

Statistical software for the main analysis is not explicitly stated.

WARNReviewer 2· 85% conf

Statistical tests are named (log-rank, Fisher's exact, Kruskal-Wallis), exact p-values are reported, and software is identified. However, effect sizes with confidence intervals are not consistently reported for key comparisons, test assumptions are not verified, and the data presentation is largely appropriate but the reliance on historical controls is a limitation.

Evidence

direct quote[Results, Primary outcomes]

“none of the 12 volunteers vaccinated by R21 who received the ID PfSPZ challenge met a primary endpoint, whereas volunteers for all other groups met primary endpoints between days 12 and 21 ( P < 0.0005 by log-rank survival across all groups)”

direct quote[Results, Primary outcomes; Discussion, paragraph 1]

“R21 provided high levels of protective efficacy against PfSPZ challenge by ID, but we found no evidence of efficacy against PfSPZ challenge by DVI (that is, 0 out of 12 volunteers challenged by ID met the primary endpoint of requiring treatment versus 5 out of 5 challenged by DVI, P < 0.001 by Fisher’s two-sided test).”

direct quote[Methods, Statistical analysis]

“A randomization list in the form of password protected spreadsheet was generated using STATA”

WARNReviewer 3· 85% conf

Statistical tests are named (log-rank, Fisher's exact test, Kruskal-Wallis), exact p-values are reported for primary and secondary endpoints, and software is identified. However, effect sizes/confidence intervals are not reported for the primary comparison, assumptions for the log-rank test are not verified, and the data presentation for the primary endpoint is adequate but sample sizes are small.

Evidence

direct quote[Abstract, Results, Figure 3 legend]

“P < 0.0005 by log-rank survival across all groups”

absence[Results, 'Primary outcomes']

Effect sizes or confidence intervals are not reported for the efficacy analysis.

The paper provides a data availability statement with a link to a repository (Harvard Dataverse, DOI provided). The paper states that individual-level data will be made available through a data governance committee. No statement about code sharing is found. The trial registration numbers are provided.

Sub-criteria

code sharingNOT REPORTED

accession numbersN/A

repository depositADEQUATE

data availability statementADEQUATE

Per reviewer (3) — the votes behind the verdict

WARNReviewer 1· 90% conf

A data availability statement is present and data are deposited in a repository (Harvard Dataverse), which is adequate. However, code sharing is not explicitly reported, making the overall assessment a warn.

Evidence

direct quote[Data availability section]

“Data are available through the online repository for KEMRI–Wellcome Trust Research Programme: Harvard Dataverse at 10.7910/DVN/TNHS14.”

direct quote[Data availability section]

“Individual-level data, excluding personal identifiers, will be made available in accordance with an application to the Data Governance Committee, which meets monthly (dgc@kemri-wellcome.org). There are no timing restrictions on the availability of data.”

absence[Data availability section]

No statement about code availability is made.

WARNReviewer 2· 90% conf

A data availability statement exists with a repository link on Harvard Dataverse, but the data access is managed (requires application to a Data Governance Committee), which is understandable for trial data. Code sharing is not mentioned.

Evidence

direct quote[Data availability]

“Data are available through the online repository for KEMRI–Wellcome Trust Research Programme: Harvard Dataverse at 10.7910/DVN/TNHS14”

absence[Data availability, Code availability]

Code sharing not reported

WARNReviewer 3· 90% conf

A data availability statement is present with a route for accessing individual-level data through a data governance committee, but the code used for analysis is not shared and no custom code repository is mentioned.

Evidence

direct quote[Data availability section]

“Data are available through the online repository for KEMRI–Wellcome Trust Research Programme: Harvard Dataverse at 10.7910/DVN/TNHS14. Individual-level data, excluding personal identifiers, will be made available in accordance with an application to the Data Governance Committee”

absence[Data availability section]

Custom analysis code is not shared.

The methods are comprehensive, including detailed descriptions of vaccines, challenge agent, randomization, CHMI procedures, safety assessments, and immunology assays. The study is registered at ClinicalTrials.gov and PACTR with registration numbers. A CONSORT flow diagram is provided (Figure 1). Limitations are discussed in the Discussion section. Conclusions are proportional to the evidence, not overclaiming from a small sample. Funding sources and competing interests are transparently reported. No formal reporting checklist is explicitly mentioned beyond the 'Reporting Summary' link.

Sub-criteria

funding coiADEQUATE

trial registrationADEQUATE

reporting guidelineNOT REPORTED

methods completenessADEQUATE

all outcomes reportedADEQUATE

limitations discussedADEQUATE

conclusions proportionalADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

Reporting is generally transparent: methods are detailed, the study is registered, limitations are discussed, conclusions are proportional, and funding/COI are stated. The absence of a formal reporting guideline (CONSORT) is a minor omission.

Evidence

direct quote[Abstract and Methods, 'Ethics']

“The study was registered with ClinicalTrials.gov ( NCT03947190 ) and PACTR ( PACTR202108505632810 ).”

direct quote[Discussion, paragraph 5]

“Our study has some limitations. We relied on historical controls for PfSPZ challenge by DVI and prior malaria exposure appears to have been higher in this group... A further limitation is the sample size.”

paraphrase[Acknowledgements and Competing interests]

“Funding sources (Wellcome Trust, EDCTP) and competing interests (including co-inventor patents on R21 and Sanaria employee status) are disclosed.”

PASSReviewer 2· 90% conf

The trial is registered, a CONSORT diagram is included, methods are detailed enough for replication, all prespecified outcomes are reported, limitations are discussed, conclusions are proportional, and funding/COI statements are provided.

Evidence

direct quote[Abstract, Methods, Ethics]

“The study was registered with ClinicalTrials.gov ( NCT03947190 ) and PACTR ( PACTR202108505632810 )”

direct quote[Figure 1]

“Fig. 1 CONSORT diagram showing volunteer flow.”

direct quote[Results, Primary outcomes]

“Following vaccination with viral vectors encoding ME-TRAP... ME-TRAP was not protective against CHMI in our study”

PASSReviewer 3· 90% conf

The study is registered, methods are detailed enough for replication, all pre-specified outcomes are reported, limitations are discussed, and conclusions are proportional to the evidence. A reporting guideline (CONSORT-like flow diagram) is present.

Evidence

direct quote[Abstract]

“The study was registered with ClinicalTrials.gov (NCT03947190) and PACTR (PACTR202108505632810)”

direct quote[Discussion, paragraph 4]

“Our study has some limitations. We relied on historical controls for PfSPZ challenge by DVI and prior malaria exposure appears to have been higher in this group”

direct quote[Discussion, last paragraph]

“Our data suggest that the latter approach is tractable and could be used to derive antibody thresholds for protection to facilitate immunobridging studies”

13 copyedit issues flagged: mostly typo, consistency, other.

Checked 44 references: 2 verified — 3 unresolved, 39 not checked.

Reproducibility

3 data/code links checked; 3 live.

Registered (1 ID: ClinicalTrials.gov). Reporting guideline cited: CONSORT.

Adcurare Rigor Action ItemsFinal pass before journal submission

Ready after moderate revision: the core findings are valid, but the authors must add a sample-size justification linked to the ID vs DVI comparison, report effect sizes with CIs for the primary endpoint, provide a code-sharing statement, complete missing table references and typos flagged by copyedit, and verify the three references not found in registry.

1.
CRITICALrigor
Add a sample-size / power analysis section to Methods 'Statistical analysis' that specifically justifies the n=12 ID vs n=5 DVI comparison in the R21 group, stating the assumed effect size, alpha, and power. The current power analysis (90% power for n=20) does not match the actual group sizes and is misleading.
Without this, a reviewer cannot assess whether the study was adequately powered for its primary comparison.
2.
CRITICALreporting
Report an effect size (e.g., risk ratio or odds ratio) with a 95% confidence interval for the primary efficacy comparison of R21 ID vs R21 DVI in Results 'Primary outcomes', alongside the Fisher's exact p-value.
P-values alone do not convey the magnitude or precision of the treatment effect; this is a standard reporting requirement for clinical trials.
3.
HIGHreporting
Add a code sharing statement in the Data availability section, depositing the custom analysis scripts (STATA do-files, SeekDeep configs) in a public repository (e.g., GitHub) and linking the DOI.
Reproducibility requires code sharing; its absence is a common reviewer objection even for clinical trial data with managed access.
4.
HIGHreporting
Verify and correct the three references that could not be found in any registry (titles: 'Safety and efficacy of malaria vaccine candidate R21/Matrix-M in African children...', 'Subcutaneous administration of a monoclonal antibody to prevent malaria', 'First results of phase 3 trial of RTS,S/AS01 malaria vaccine in African children') — replace with correctly cited, verifiable references or provide evidence they exist.
Unresolvable references are a fabrication signal that editors and reviewers will investigate.
5.
HIGHrigor
Report the baseline health status and comorbidity profile of enrolled participants in a structured table (Table 1 or a supplementary table), beyond the exclusion criteria list.
Health status affects immune responses and generalizability; its absence weakens the biological_variables dimension.
6.
HIGHreporting
Temper or remove the claim that the DVI vs ID finding 'explains the leaky protection' of RTS,S/R21 in field settings (Discussion), because the paper does not demonstrate the same mechanism operates under natural mosquito-bite conditions — state it as a hypothesis consistent with the data, not a conclusion.
The claim audit flagged this as overstated; over-claiming is a frequent reviewer objection and can undermine the paper's credibility.
7.
HIGHreporting
Temper or remove the speculative claim that 'more potent or higher-titer anti-CSP antibodies may be protective against DVI' (Discussion), as the paper provides no evidence for any achievable antibody level that protects against DVI — state it as an open question.
This claim was also flagged as overstated; it extrapolates beyond the data and invites inappropriate conclusions.
8.
MEDIUMstatistics
Add a statement verifying the proportional hazards assumption for the log-rank tests (e.g., visual inspection of Kaplan-Meier curves for crossing hazards) or note that the non-parametric log-rank test does not strictly require proportional hazards but the interpretation assumes it (Methods 'Statistical analysis').
Unverified test assumptions weaken confidence in the primary analysis.
9.
MEDIUMreporting
Insert the missing table numbers in Results: '(Table 1)' after 'mean age of 28.3 years' and '(Table 3)' after 'solicited adverse events'.
Blank table references (Table ) are copyedit errors that disrupt readability and professionalism.
10.
MEDIUMreporting
Fix the typo 'that ism' to 'that is, meeting' in Methods 'CHMI' and restructure the run-on sentence in Methods 'Statistical analysis' by replacing commas with semicolons: 'Safety is reported ITT; immunogenicity is reported according-to-protocol; efficacy in CHMI is reported ITT for the cohort undergoing CHMI.'
These copyedit issues are minor but would be noticed by a careful reviewer.
11.
MEDIUMreporting
Provide lot numbers for the investigational vaccines (R21, ChAd63/MVA ME-TRAP) and the Sanaria PfSPZ Challenge, if available, in the Methods section.
Lot numbers are standard for traceability in clinical trial reporting.
12.
MEDIUMreporting
Report version numbers for all software tools: STATA (used for randomization and likely analysis), REDCap, and any qPCR analysis software (Methods).
Versioning ensures reproducibility, as different versions can produce different results.
13.
MEDIUMreporting
Clarify in the Data availability statement whether the Harvard Dataverse deposit contains raw individual-level participant data or only aggregate data; if raw data are deposited, confirm that privacy and consent terms allow this.
The current statement is ambiguous; a reviewer may question what is actually available.
14.
LOWcopyedit
Add a comma after 'volunteers' in the Abstract sentence: 'R21 vaccinated volunteers receiving ID challenge met the prespecified treatment criteria for the primary endpoint.'
Minor clarity fix.
15.
LOWcopyedit
Fix duplicate 'according to' in Extended Data Fig. 2 legend: change 'varied according to timepoint according to' to 'varied by timepoint according to'.
Minor grammatical cleanup.

Full text (53,582 chars)Analyzed: Jul 7, 2026

Read alongside

Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.

Read full text (PMC)

Journal

DOI

10.1038/s41591-025-04107-6

Share this Rigor Review

Post on X Share on LinkedIn Share via Email

Embed this Rigor badge

<a href="https://adcurare.com/verify/82bbc4de-cf59-4527-ba7e-1a4a24cf8619" target="_blank" rel="noopener">
  <img src="https://adcurare.com/verify/82bbc4de-cf59-4527-ba7e-1a4a24cf8619/badge" alt="Adcurare Rigor Review — 1★ (Critical), 2 critical, 5 high issues for “Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.”" width="440" height="104" style="max-width:100%;height:auto" />
</a>

Every embed links back to this Rigor Record.

Record fingerprint

a9177f05df30bfc882ac8763e80172252e154abc34f167c9250e25ef5cb9ad09

Verify via API

Issued Jul 7, 2026Engine 7.6.0

Adcurare assesses methodological rigor, not the importance of the findings. See how we evaluate →